Target (protein/gene name): Disulfide Oxidoreductase (DsbA) NCBI Gene # or RefSeq#: 3093150 Protein ID (NP or XP #) or Wolbachia#: NC_006350.1 Organism (including strain): Burkholderia Pseudomallei (strain K96243) Etiologic Risk Group (see link below): CDC Category B biological threat agent Disease Information (sort of like the Intro to your Mini research write up): Melioidosis, also called Whitmore's disease, is an infectious disease that can infect humans or animals. The disease is caused by the bacteriumBurkholderia pseudomallei. B. pseudomallei is a pathogenic gram-negative bacteria that causes a disease called melioidosis and is a soil bacteria endemic to Southeast Asia and Northern Australia. Melioidosis can cause both chronic and acute forms and it causes pain in chest, bones, or joints; cough; skin infections, lung nodules and pneumonia. The current treatment of the disease is expensive and generally starts with intravenous (within a vein) antimicrobial therapy for 10-14 days followed by a long dosage of oral antibiotics. Melioidosis comes mostly from contact with contaminated soils such as working on a rice field. Melioidosis can also be engineered to be used as a biological warfare agent. If untreated melioidosis has a mortality rate that exceeds 90% and if treated with antibiotics the mortality rate is still as low as 10% and recurrence occurs in 10-20% of patients. Link to TDR Targets page (if present): n/a Link to Gene Database page: Essentiality of this protein: DSB proteins play a role in bacterial and are essential for the proper folding and activity of a range of virulence factors in a number of bacterial species including clinically significant pathogens such as Pseudomonas aeruginosa, enteropathogenic Escherichia coli, and Neisseria meningitidis. DsbA presents an opportunity to disrupt multiple downstream virulence effectors via its inhibition. Interrogation of the sequenced genome of B. pseudomallei identified a DsbA homologue, prompting investigation for it as a potential essential mediator of virulence in this pathogen. This study was undertaken in the paper “Disarming Burkholderia pseudomallei: structural and functional characterization of a disulfide oxidoreductase (DsbA) required for virulence in vivo.” http://europepmc.org/articles/pmc3901323
Complex of proteins?:No Druggable Target (list number or cite evidence from a paper/database showing druggable in another organism): Data presented in paper “Disarming Burkholderia pseudomallei: structural and functional characterization of a disulfide oxidoreductase (DsbA) required for virulence in vivo.” Suggested that DsbA is an essential mediator of virulence inB. pseudomalleiand that its disruption has pleiotropic effects, validating it as a promising drug target in the organism tested (mice). http://europepmc.org/articles/pmc3901323
*EC#: 1.8.4.2 potential EC number multiple were given however none of the ECs listed related to the organism of interest Burkholderia Pseudomalle.
Determined an applicable EC number as although the disuphide oxidoreductase is shown it does not correspond to the organism Burkholderia pseudomallei but instead corresponds to the organism Pseudomonas aeruginosa. This is allowed as when run through the program Blast Pro Pseudomonas aeruginosa came up as a similar organism and it was also mentioned in the paper “Disarming Burkholderia pseudomallei: structural and functional characterization of a disulfide oxidoreductase (DsbA) required for virulence in vivo.” about their alikeness.
Purification Method and expression: Can have a His-Tag and purified using Nickel column chromatography. For crystallization experiments and all biochemical characterizations (except the insulin reduction assay) the N-terminal His6-tagged BpsDsbA construct was expressed and purified as previously described for PaDsbA. For the insulin reduction assay, the C-terminal His6-tag construct was expressed inE. coli BL21 (DE3) at 310 K under isopropyl β-D-thiogalactopyranoside induction and purified using immobilized metal affinity chromatography. Additional details of cloning, expression, and purification methods are provided inSupplementary Data. http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3901323/
Figure 1 - PDB PyMOL representation of the protein Disulfide Oxidoreductase
Figure 2 - (A) Superposition of the crystal structure of BpsDsbA upon its closest structural homologue PaDsbA, and EcDsbA. BpsDsbA is colored light green, PaDsbA is colored dark green, and EcDsbA is colored magenta. The sulfur atoms of Cys 43 and Cys 46 of the active site in BpsDsbA are shown as spheres and colored yellow. The β5-α7 loop that is significantly shortened in BpsDsbA and PaDsbA, relative to EcDsbA, and the loop that is differently positioned between BpsDsbA and PaDsbA, and EcDsbA are each highlighted with a dashed ellipse. Enlarged views of the β5-α7 and β3-α2 loops are shown in the adjacent panels. (B) Surface representation of BpsDsbA (upper left panel) and EcDsbA (upper right panel), illustrating the nature of the DsbB-engaging groove (indicated with a dashed ellipse) positioned immediately beneath the active site (indicated with an S). The view has been rotated 45° anticlockwise about the Y-axis relative to A. Surface residues are colored on a gradient from white to dark green according to the Eisenberg hydrophobicity scale; white indicates most hydrophobic, dark green indicates least hydrophobic. In BpsDsbA the β5-α7 loop is three residues shorter than in EcDsbA. This directly impacts upon the depth and extent of the putative DsbB-engaging groove. Figures were generated using Pymol (www.pymol.org/).
*length of your protein in Amino Acids: 200 Amino Acids
Molecular Weight of your protein in kiloDaltons using the Expasy ProtParam website:21996.1 kD
Molar Extinction coefficient of your protein at 280 nm wavelength:23045 M-1 cm-1
TMpred graph Image (http://www.ch.embnet.org/software/TMPRED_form.html). Input your amino acid sequence to it. Figure 3 two possible models considered, only significant TM-segments used - probably no transmembrane protein - no possible model found
*CDS Gene Sequence (paste as text only): - using http://www.bioinformatics.org/sms2/rev_trans.html >reverse translation of Untitled to a 450 base sequence of most likely codons. agcaacgcggcgggctttgcgcaggcgagcccgagcgcgccggtggcgggcaaagatttt gaagtgatgaaaagcccgcagccggtgagcgcgccggcgggcaaagtggaagtgattgaa tttttttggtatggctgcccgcattgctatgaatttgaaccgaccattgaagcgtgggtg aaaaaacagggcgataaaattgcgtttaaacgcgtgccggtggcgtttcgcgatgatttt gtgccgcatagcaaactgttttatgcgctggcggcgctgggcgtgagcgaaaaagtgacc ccggcggtgtttaacgcgattcataaagaaaaaaactatctgctgaccccgcaggcgcag gcggattttctggcgacccagggcgtggataaaaaaaaatttctggatgcgtataacagc tttagcgtgcagggccaggtgaaacagagc
Assay Data:
Insulin reduction assay:
The insulin reduction assay was carried out as previously described (35). Briefly, reaction mixtures were prepared containing 8 μM recombinant BpsDsbA or recombinant thioredoxin from E. coli 0.1 M phosphate buffer, 2 mM ethylenediaminetetraacetic acid (EDTA), and 0.35 mM DTT. The reactions were started by adding insulin to a final concentration of 131 μM and the reduction of insulin was monitored at A650 for 80 min at 20 s intervals using a Shimadzu 1800 UV/visible spectrophotometer. The non-catalyzed reduction of insulin by DTT was monitored in a control reaction without catalyst.
NCBI Gene # or RefSeq#: 3093150
Protein ID (NP or XP #) or Wolbachia#: NC_006350.1
Organism (including strain): Burkholderia Pseudomallei (strain K96243)
Etiologic Risk Group (see link below): CDC Category B biological threat agent
Disease Information (sort of like the Intro to your Mini research write up): Melioidosis, also called Whitmore's disease, is an infectious disease that can infect humans or animals. The disease is caused by the bacterium Burkholderia pseudomallei. B. pseudomallei is a pathogenic gram-negative bacteria that causes a disease called melioidosis and is a soil bacteria endemic to Southeast Asia and Northern Australia. Melioidosis can cause both chronic and acute forms and it causes pain in chest, bones, or joints; cough; skin infections, lung nodules and pneumonia. The current treatment of the disease is expensive and generally starts with intravenous (within a vein) antimicrobial therapy for 10-14 days followed by a long dosage of oral antibiotics. Melioidosis comes mostly from contact with contaminated soils such as working on a rice field. Melioidosis can also be engineered to be used as a biological warfare agent. If untreated melioidosis has a mortality rate that exceeds 90% and if treated with antibiotics the mortality rate is still as low as 10% and recurrence occurs in 10-20% of patients.
Link to TDR Targets page (if present): n/a
Link to Gene Database page:
Essentiality of this protein: DSB proteins play a role in bacterial and are essential for the proper folding and activity of a range of virulence factors in a number of bacterial species including clinically significant pathogens such as Pseudomonas aeruginosa, enteropathogenic Escherichia coli, and Neisseria meningitidis. DsbA presents an opportunity to disrupt multiple downstream virulence effectors via its inhibition. Interrogation of the sequenced genome of B. pseudomallei identified a DsbA homologue, prompting investigation for it as a potential essential mediator of virulence in this pathogen. This study was undertaken in the paper “Disarming Burkholderia pseudomallei: structural and functional characterization of a disulfide oxidoreductase (DsbA) required for virulence in vivo.”
http://europepmc.org/articles/pmc3901323
Is it a monomer or multimer as biological unit? (make prediction at http://www.ebi.ac.uk/msd-srv/prot_int/pistart.html): structure is monometric.
Complex of proteins?: No
Druggable Target (list number or cite evidence from a paper/database showing druggable in another organism): Data presented in paper “Disarming Burkholderia pseudomallei: structural and functional characterization of a disulfide oxidoreductase (DsbA) required for virulence in vivo.” Suggested that DsbA is an essential mediator of virulence inB. pseudomalleiand that its disruption has pleiotropic effects, validating it as a promising drug target in the organism tested (mice).
http://europepmc.org/articles/pmc3901323
*EC#: 1.8.4.2 potential EC number multiple were given however none of the ECs listed related to the organism of interest Burkholderia Pseudomalle.
Link to BRENDA EC# page:
http://www.brenda-enzymes.org/enzyme.php?ecno=1.8.4.2
2 glutathione + protein-disulfide = glutathione-disulfide + protein-dithiol
Determined an applicable EC number as although the disuphide oxidoreductase is shown it does not correspond to the organism Burkholderia pseudomallei but instead corresponds to the organism Pseudomonas aeruginosa. This is allowed as when run through the program Blast Pro Pseudomonas aeruginosa came up as a similar organism and it was also mentioned in the paper “Disarming Burkholderia pseudomallei: structural and functional characterization of a disulfide oxidoreductase (DsbA) required for virulence in vivo.” about their alikeness.
Purification Method and expression: Can have a His-Tag and purified using Nickel column chromatography.
For crystallization experiments and all biochemical characterizations (except the insulin reduction assay) the N-terminal His6-tagged BpsDsbA construct was expressed and purified as previously described for PaDsbA. For the insulin reduction assay, the C-terminal His6-tag construct was expressed in E. coli BL21 (DE3) at 310 K under isopropyl β-D-thiogalactopyranoside induction and purified using immobilized metal affinity chromatography. Additional details of cloning, expression, and purification methods are provided in Supplementary Data.
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3901323/
PDB protein file: 4k2d http://www.rcsb.org/pdb/explore/explore.do?structureId=4k2d
Image of protein:
Molecular Weight of your protein in kiloDaltons using the Expasy ProtParam website:21996.1 kD
Molar Extinction coefficient of your protein at 280 nm wavelength: 23045 M-1 cm-1
TMpred graph Image (http://www.ch.embnet.org/software/TMPRED_form.html). Input your amino acid sequence to it.
Figure 3 two possible models considered, only significant TM-segments used - probably no transmembrane protein - no possible model found
*CDS Gene Sequence (paste as text only): - using
http://www.bioinformatics.org/sms2/rev_trans.html
>reverse translation of Untitled to a 450 base sequence of most likely codons. agcaacgcggcgggctttgcgcaggcgagcccgagcgcgccggtggcgggcaaagatttt gaagtgatgaaaagcccgcagccggtgagcgcgccggcgggcaaagtggaagtgattgaa tttttttggtatggctgcccgcattgctatgaatttgaaccgaccattgaagcgtgggtg aaaaaacagggcgataaaattgcgtttaaacgcgtgccggtggcgtttcgcgatgatttt gtgccgcatagcaaactgttttatgcgctggcggcgctgggcgtgagcgaaaaagtgacc ccggcggtgtttaacgcgattcataaagaaaaaaactatctgctgaccccgcaggcgcag gcggattttctggcgacccagggcgtggataaaaaaaaatttctggatgcgtataacagc
tttagcgtgcagggccaggtgaaacagagc
Assay Data:
Insulin reduction assay:
The insulin reduction assay was carried out as previously described (35). Briefly, reaction mixtures were prepared containing 8 μM recombinant BpsDsbA or recombinant thioredoxin from E. coli 0.1 M phosphate buffer, 2 mM ethylenediaminetetraacetic acid (EDTA), and 0.35 mM DTT. The reactions were started by adding insulin to a final concentration of 131 μM and the reduction of insulin was monitored at A650 for 80 min at 20 s intervals using a Shimadzu 1800 UV/visible spectrophotometer. The non-catalyzed reduction of insulin by DTT was monitored in a control reaction without catalyst.
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3901323/
Pricing:
Glutathione 500mg $52.60
http://www.sigmaaldrich.com/catalog/product/fluka/phr1359?lang=en®ion=US